Aa
VL showing 715 andTMA Pos at Week 24 (after being TMA Neg since wk 4)
Am 60 yr. old, geno 2b, VL was 2,387,610 at beginning of 24-week treatment in July ’07. Did INT 180mcg, 1200 Riba until 10/2, then 1000 Riba daily for rest of tx. Results of tx had been ideal from the start – was UND (HCV RNA <615) and TMA negative at 4 weeks (8/29) and continued same at weeks 8, 12, and 16. Then, at week 20, I tested HCV RNA<615 and TMA positive, retested at week 22 and the HCV RNA is at 715, TMA positive. I did my last injection (of 24) last Friday and am on my last week of riba. I have an appointment with my doctor today to discuss. I am having another fasting blood test this week. Has anyone had a similar experience, and do these recent results mean the tx is not working after all and that I should stop tx and wait for a better treatment down the road? I have one refill of 4 injections of INT left I could use, plus enough riba for another 4 weeks. Would an additional 4 weeks tx with an increased dose of riba (1200-1400 daily) make a difference with the results I’m getting right now? I’m sure my Dr. and I will discuss this today, but I wanted to have an idea of what others have to say. Thanks for your help! Skip
Yes, the word "adequate" was used referring to flat riba dosage, but at the same time weight-based was considered "more effective" -- and esp for those in the heavier weight group.
The other point, is that -- and not sure if you are -- we may be comparing apples and oranges with the "48 weeks not more effective than 24" treatise. My understanding is that this refers to treatment cohorts as a group, and not sub-chorts who treat for 24 weeks, have a viral breakthrough, re-group perhaps with a change in meds -- and then treat for another 12 or 24 weeks. One could argue that the latter might be considered a version of re-treatment, as opposed to simply treating 48 weeks from the get go.
In other words, say Skip was in one these studies. What probably would have happened is that all these interim viral load test would not have been taken, an RVR therefore would have been assumed, he would have treated 48 weeks on the same dosages (assuming he was in that cohort) and he would most probably have relapsed.
This, of course, is not what I was suggesting so I really don't think the repetition of the 48 week study is germane in this case. One member I can think of, who followed something close -- but not exact to Ski's, situation, was Kalio, although in her case I believe there was around a one week gap between treatments.
Just want to be clear that I'm not recommending that Skip extend (or re-treat immed) another 12 or 24 weeks, esp since he has zero liver damage. But what I am saying is that since he's already invested almost 24 weeks, consideration should be given to such a strategy and I'm throwing out a 12 week compromise plan that assumes he will be UND within the next couple of weeks. The plan includes uppint the riba to 1400, possibly Procrit (epo) and very frequent VL test (every 2 weeks) with the understanding that treatment stops with another breakthrough via sensitive TMA.
As you probably know, I'm a big fan of cutting losses (esp no significant liver damage) when the odds are stacked against you in treatment. Cutting losses to treat another day. I just feel in this individual case, given his weight and prior dosing, and relapse coincidental with the riba reduction -- that this may be a correctable (and measurable) mistake -- and with 24 weeks invested, another 12 might be a reasonable stab at SVR.
BTW, haven't been following this geno thing -- and not sure I have the energy left to start scrolling up on this new format :) -- but from what I do remember, really don't see the focus on this. Why would skip have more of a chance of a double-genotype than anyone else? He's certainly not the first RVR to relapse. Anyway, it may be academic, because hopefully the upped riba will bring him below the level where genotype can be measured -- the UND level that is.
-- Jim
The other point, is that -- and not sure if you are -- we may be comparing apples and oranges with the "48 weeks not more effective than 24" treatise. My understanding is that this refers to treatment cohorts as a group, and not sub-chorts who treat for 24 weeks, have a viral breakthrough, re-group perhaps with a change in meds -- and then treat for another 12 or 24 weeks. One could argue that the latter might be considered a version of re-treatment, as opposed to simply treating 48 weeks from the get go.
In other words, say Skip was in one these studies. What probably would have happened is that all these interim viral load test would not have been taken, an RVR therefore would have been assumed, he would have treated 48 weeks on the same dosages (assuming he was in that cohort) and he would most probably have relapsed.
This, of course, is not what I was suggesting so I really don't think the repetition of the 48 week study is germane in this case. One member I can think of, who followed something close -- but not exact to Ski's, situation, was Kalio, although in her case I believe there was around a one week gap between treatments.
Just want to be clear that I'm not recommending that Skip extend (or re-treat immed) another 12 or 24 weeks, esp since he has zero liver damage. But what I am saying is that since he's already invested almost 24 weeks, consideration should be given to such a strategy and I'm throwing out a 12 week compromise plan that assumes he will be UND within the next couple of weeks. The plan includes uppint the riba to 1400, possibly Procrit (epo) and very frequent VL test (every 2 weeks) with the understanding that treatment stops with another breakthrough via sensitive TMA.
As you probably know, I'm a big fan of cutting losses (esp no significant liver damage) when the odds are stacked against you in treatment. Cutting losses to treat another day. I just feel in this individual case, given his weight and prior dosing, and relapse coincidental with the riba reduction -- that this may be a correctable (and measurable) mistake -- and with 24 weeks invested, another 12 might be a reasonable stab at SVR.
BTW, haven't been following this geno thing -- and not sure I have the energy left to start scrolling up on this new format :) -- but from what I do remember, really don't see the focus on this. Why would skip have more of a chance of a double-genotype than anyone else? He's certainly not the first RVR to relapse. Anyway, it may be academic, because hopefully the upped riba will bring him below the level where genotype can be measured -- the UND level that is.
-- Jim
skip: good to hear you're holding up well at the weight-based rbv dosage. If you do decide to immediately start another 6-month round you might want to also talk to your Dr. about weight-based ifn dosing.
Though it's routine to extend tx to 48 after failing on 24 for g2/g3s there is strong evidence that this is of marginal value:
"The current study, with its larger patient population and identical PEG-IFN doses in both treatment arms, establishes more firmly the conclusions about the equivalence of 24 and 48 weeks of treatment in patients with G2 and G3 reached by Hadziyannis et al"
(from the winr study cited above)
thus the only significant variables available for adjustment in the next round are the type/dosage of ifn (and possibly an ntz adjunct). The sequencing test is a long-shot, but it should at least give you the genotype of the survivors without the 4000VL requirement of the commercial tests. *Something* accounts for the emergence of soc-resistance after such a good start; identifying it might help lessen the disappointment. Anyway, good luck on Monday (and beyond!)
all: as often happens, I got my right and left switched. The highly-conserved region of the hcv genome (as in 1-300 above) are at the 5' utr, the 5b polymerase is at the 3' end.
Though it's routine to extend tx to 48 after failing on 24 for g2/g3s there is strong evidence that this is of marginal value:
"The current study, with its larger patient population and identical PEG-IFN doses in both treatment arms, establishes more firmly the conclusions about the equivalence of 24 and 48 weeks of treatment in patients with G2 and G3 reached by Hadziyannis et al"
(from the winr study cited above)
thus the only significant variables available for adjustment in the next round are the type/dosage of ifn (and possibly an ntz adjunct). The sequencing test is a long-shot, but it should at least give you the genotype of the survivors without the 4000VL requirement of the commercial tests. *Something* accounts for the emergence of soc-resistance after such a good start; identifying it might help lessen the disappointment. Anyway, good luck on Monday (and beyond!)
all: as often happens, I got my right and left switched. The highly-conserved region of the hcv genome (as in 1-300 above) are at the 5' utr, the 5b polymerase is at the 3' end.
thanks. I will ask about the sequencing test. I have increased the dose of riba to 1200 (for 4 days) and have been on 1400/day for a week now. Not noticing much difference healthwise - just fatigue as usual. And I did a CBC yesterday - I did one last Thursday, after being on 1200 for four days and that one had my hgb drop from 13.4 to 12.8, but then after 1400 for a week yesterday's came back at 13.5, Hct 40.6. Am feeling good about this! Seems to perhaps mean I've already started leveling out with the new dose. Next Monday will do a fasting test which will include VL (HCV RNA and TMA). Then we'll see if I'm UND again. If so, I believe we are going to go forward another 6 months with tests every other week or so to make sure I'm staying UND. If not, then I guess it's all over for now.
skip
skip
skip: that 4000 min seems high for a genotype determination - it might be well worth checking around a bit and seeing if you can find a lab with a more sensitive protocol. You might also want to ask your Dr. whether she's willing to order a sequencing test - any research med center should be equipped to run it, though it's not part of conventional therapy. At the moment you have an interesting and unusual opportunity observe virus that became detectable only after 6 months of apparently successful ifn/rbv dosing - information that could help guide future tx. This window could easily close if you either increase the dose or discontinue (the hardy ifn-resistant variety will likely be supplanted by garden-variety ifn-sensitive but quick-breeding virus).
Overall the outlook doesn't look too promising -that bug is happily ignoring what you're throwing at it. The WIN-R study pretty much confirmed that longer tx has no bearing on g2/g3 outcome so your remaining weapons are : higher ifn&rbv dosage, different ifn and possibly ntz/alinia as an adjunct. I wouldn't stress about the rescue meds yet - your CBC numbers look pretty good. All the best.
goof/all : OK, that post above may have been a bit geeky. However, discussion of genotypes/subtypes comes up all the time around here. The exercise of going to genbank, getting typical sequences for 1a.1b,2a etc. and aligning them to see what the family resemblances actually look like should help dispel the mystery a bit.
BTW it looks like our middle column has gotten a bit wider! Used to be those genbank URLS were too wide to be readable..
Overall the outlook doesn't look too promising -that bug is happily ignoring what you're throwing at it. The WIN-R study pretty much confirmed that longer tx has no bearing on g2/g3 outcome so your remaining weapons are : higher ifn&rbv dosage, different ifn and possibly ntz/alinia as an adjunct. I wouldn't stress about the rescue meds yet - your CBC numbers look pretty good. All the best.
goof/all : OK, that post above may have been a bit geeky. However, discussion of genotypes/subtypes comes up all the time around here. The exercise of going to genbank, getting typical sequences for 1a.1b,2a etc. and aligning them to see what the family resemblances actually look like should help dispel the mystery a bit.
BTW it looks like our middle column has gotten a bit wider! Used to be those genbank URLS were too wide to be readable..
Updating, my VL came back and it has gone from 773 to 803. I started back on 1200mg riba Monday-Weds and now am doing 1400mg riba starting yesterday. The Geno test was unable to be completed (evidently they need at least 4000 VL to get a reading). Had blood work done this morning and the readings are: WBC 4.2; ANC 2.45; Platelets 184; Hgb 12.8; and Hct 38.3. My doc says since I am so close to being UND she now wants me to continue at 1400 riba and in two weeks do another VL test to see if I can get to UND again. At those test results, if I am UND, she will want me to continue for another period of time (probably another 24 weeks). If the VL has gone up, it will be considered a breakthrough and we will quit. Decided I’m not going to worry about it until the time comes.
Am concerned about Procrit/epogen. I was trying to avoid multiple injections during tx, but now it appears inevitable. I believe my counts are currently ok but I’m told if my Hgb gets near around 11 the doc will pre-cert epo for me to start if it goes <11. Yikes more injections! Am told that headaches many times come with procrit. Also if I need neupogen later, too - not sure what the sx are for that one (although they seem to think I’m ok there), I’ll really be a pincushion for awhile! Does anyone here have a good formula for the timing of injections of IFN and Procrit/epo to avoid problems or am I worrying ahead of time again for nothing? Just trying to get a grip here on what I'm letting myself in for.
Leaving work for the day. Thanks again for everyone's help and good wishes. Hope everyone has a nice weekend!
Skip
Am concerned about Procrit/epogen. I was trying to avoid multiple injections during tx, but now it appears inevitable. I believe my counts are currently ok but I’m told if my Hgb gets near around 11 the doc will pre-cert epo for me to start if it goes <11. Yikes more injections! Am told that headaches many times come with procrit. Also if I need neupogen later, too - not sure what the sx are for that one (although they seem to think I’m ok there), I’ll really be a pincushion for awhile! Does anyone here have a good formula for the timing of injections of IFN and Procrit/epo to avoid problems or am I worrying ahead of time again for nothing? Just trying to get a grip here on what I'm letting myself in for.
Leaving work for the day. Thanks again for everyone's help and good wishes. Hope everyone has a nice weekend!
Skip
JM: "Willing's "Pegasys" comment is germane"
Well, that's an improvement, as so much of it is often greek to me!!
Well, that's an improvement, as so much of it is often greek to me!!
So, what is a good place to buy Circumin? I see it all over the place when I google. Looking for a specific name/ brand/ price. Besides the LEF one, which is way over my budget.
looks like the post software kinda butchered that alignment. If interested, you can rerun it kust getting the first 300 nucleotides from those three genbank accessions and pasting them into a multiple-alignment server like
http://www.genebee.msu.su/services/malign_reduced.html
http://www.genebee.msu.su/services/malign_reduced.html
looks like the post software kinda butchered that alignment. If interested, you can rerun it kust getting the first 300 nucleotides from those three genbank accessions and pasting them into a multiple-alignment server like
http://www.genebee.msu.su/services/malign_reduced.html
http://www.genebee.msu.su/services/malign_reduced.html
this all probably falls under the heading of more detail than you want to be bothered with, but.. making sense of hcv genotypes involves both ends of hcv's 9600 nucleotide genome.
At one end is the code for the ns5b protein the virus uses to make copies of itself, the virus's polymerase. This copy machine has no proofreading capability and makes lots of mistakes, as I recall an average of a one nucleotide mistake per copy. The result is all those virions inhabiting infected cells and traveling about have slightly different sequences. Some of these changes result in defective virus which can't reproduce. Over time the variation is not uniform but tends to cluster into "quasi-species" that bear a family resemblance to one another.
The other end of the genome called the "3' utr" (untranslated region) has the property of being rather intolerant to change - basically changes here result in non-functional virus. Each of the major families has a particular collection of nucleotides in the 3'utr.
For example, equences for typical members of the 1a and 1b and 2a families are available at
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=329873
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=M58335
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=221650
If you align the first 300 nucleotides of the 3 sequences you get:
1a ( 1) GCCAGCcCCCTGATGGGGGCGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTG
1b ( 1) ---------CGATTGGGGGCGACACTCCACCATAGATCACTCCCCTGTGAGGAACTACTG
2a ( 1) ACCCGC-CCCTAATAGGGGCGACACTCCGCCATGAACCACTCCCCTGTGAGGAACTACTG
++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++.+
1a ( 61) TCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGAC
1b ( 52) TCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGAC
2a ( 60) TCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGCC
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.+
1a ( 121) CCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAG
1b ( 112) CCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAG
2a ( 120) CCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCGG
++.+++.++++++++++++++++.+++++.+++.+++++.++..++++++++++++++++
1a ( 181) GACGACCGGGTCCTTTCTTGGATCAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCC
1b ( 172) GACGACCGGGTCCTTTCTTGGATCAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCC
2a ( 180) GAAGACTGGGTCCTTTCTTGGATAAACCCACTCTATGCCCGGTCATTTGGGCGTGCCCCC
++.++++++++++++++++++.+++++++.++++++++++++++++++++++++++++++
1a ( 241) GCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGG
1b ( 232) GCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGG
2a ( 240) GCAAGACTGCTAGCCGAGTAGCGTTGGGTTGCGAAAGGCCTTGTGGTACTGCCTGATAGG
The take home message from the above is that though there is very little variation in this 300 nucleotide stretch, the 1a and 1b resemble one another much more than the 2a. A genotype test basically amplifies a stretch of rna in the 3'utr and then classifies it into one of the main known families. The commercial tests are only moderately accurate :
"Genotype identification is clinically important because genotypes 1 and 4 are more resistant than genotypes 2 and 3 to the current
standard of care, pegylated interferon- and ribavirin combination therapy.43 Indeed, most treatment protocols require genotype information to tailor dose and duration of treatment. Genotyping assays are usually based on sequence analysis of an amplified segment of the genome, commonly the 5untranslated region, because this region is targeted by most diagnostic assays for HCV RNA. Although this region is highly conserved, a well-characterized set of polymorphisms predict genotype and can be conveniently detected by probe hybridization,44,45
changes in restriction sites46,47 or by direct sequencing.48 For the purposes for which they are normally used (prediction of treatment response and dose scheduling),43 currently used 5UTR-based assays are acceptably accurate, with more than 95% concordance with genotypes identified by nucleotide sequencing in NS5B or other coding regions of the genome.49-55"
( from http://www.ncbi.nlm.nih.gov/pubmed/16149085 )
Overall very little is known about what tx-resistant virus looks like. It's interesting that your dr is trying to learn a bit about the survivors by doing a genotype test - most don't bother and just discontinue tx. The survivors will probably still be 2bs, but possibly not.
At one end is the code for the ns5b protein the virus uses to make copies of itself, the virus's polymerase. This copy machine has no proofreading capability and makes lots of mistakes, as I recall an average of a one nucleotide mistake per copy. The result is all those virions inhabiting infected cells and traveling about have slightly different sequences. Some of these changes result in defective virus which can't reproduce. Over time the variation is not uniform but tends to cluster into "quasi-species" that bear a family resemblance to one another.
The other end of the genome called the "3' utr" (untranslated region) has the property of being rather intolerant to change - basically changes here result in non-functional virus. Each of the major families has a particular collection of nucleotides in the 3'utr.
For example, equences for typical members of the 1a and 1b and 2a families are available at
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=329873
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=M58335
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=221650
If you align the first 300 nucleotides of the 3 sequences you get:
1a ( 1) GCCAGCcCCCTGATGGGGGCGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTG
1b ( 1) ---------CGATTGGGGGCGACACTCCACCATAGATCACTCCCCTGTGAGGAACTACTG
2a ( 1) ACCCGC-CCCTAATAGGGGCGACACTCCGCCATGAACCACTCCCCTGTGAGGAACTACTG
++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++.+
1a ( 61) TCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGAC
1b ( 52) TCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGAC
2a ( 60) TCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGCC
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.+
1a ( 121) CCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAG
1b ( 112) CCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAG
2a ( 120) CCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCGG
++.+++.++++++++++++++++.+++++.+++.+++++.++..++++++++++++++++
1a ( 181) GACGACCGGGTCCTTTCTTGGATCAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCC
1b ( 172) GACGACCGGGTCCTTTCTTGGATCAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCC
2a ( 180) GAAGACTGGGTCCTTTCTTGGATAAACCCACTCTATGCCCGGTCATTTGGGCGTGCCCCC
++.++++++++++++++++++.+++++++.++++++++++++++++++++++++++++++
1a ( 241) GCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGG
1b ( 232) GCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGG
2a ( 240) GCAAGACTGCTAGCCGAGTAGCGTTGGGTTGCGAAAGGCCTTGTGGTACTGCCTGATAGG
The take home message from the above is that though there is very little variation in this 300 nucleotide stretch, the 1a and 1b resemble one another much more than the 2a. A genotype test basically amplifies a stretch of rna in the 3'utr and then classifies it into one of the main known families. The commercial tests are only moderately accurate :
"Genotype identification is clinically important because genotypes 1 and 4 are more resistant than genotypes 2 and 3 to the current
standard of care, pegylated interferon- and ribavirin combination therapy.43 Indeed, most treatment protocols require genotype information to tailor dose and duration of treatment. Genotyping assays are usually based on sequence analysis of an amplified segment of the genome, commonly the 5untranslated region, because this region is targeted by most diagnostic assays for HCV RNA. Although this region is highly conserved, a well-characterized set of polymorphisms predict genotype and can be conveniently detected by probe hybridization,44,45
changes in restriction sites46,47 or by direct sequencing.48 For the purposes for which they are normally used (prediction of treatment response and dose scheduling),43 currently used 5UTR-based assays are acceptably accurate, with more than 95% concordance with genotypes identified by nucleotide sequencing in NS5B or other coding regions of the genome.49-55"
( from http://www.ncbi.nlm.nih.gov/pubmed/16149085 )
Overall very little is known about what tx-resistant virus looks like. It's interesting that your dr is trying to learn a bit about the survivors by doing a genotype test - most don't bother and just discontinue tx. The survivors will probably still be 2bs, but possibly not.
Thanks. I guess I'll find out in a few days. In the meantime, I'm continuing with Pega180/riba 1200 and if still 2b, my doc is hoping to get me down UND and if successful over the next 4 weeks we will make further decisions. I'm sure she will want a VL test in a couple to see if it is working. If it's not working, then we will stop and regroup...
Best,
Skip
Best,
Skip
Sorry Skip I missed your question to me.
Honestly I have no idea how they determine that there are two genotypes - but there are a few of us in here who have had the problem. When my doctor told me I never really thought to ask...at that point I was too upset to even think because I was sure it meant it would be so much harder to get SVR.
I know he didn't give me any unusual test though = he wasn't a very progressive or aggressive doctor when I first met him so it must be very apparent through the regular old PCR.
There are a bunch of us who have the combo problem so maybe one of them knows...I'm sorry I just don't but I seriously doubt you have a dual geno, you'd know it if you did I'm pretty sure.
Honestly I have no idea how they determine that there are two genotypes - but there are a few of us in here who have had the problem. When my doctor told me I never really thought to ask...at that point I was too upset to even think because I was sure it meant it would be so much harder to get SVR.
I know he didn't give me any unusual test though = he wasn't a very progressive or aggressive doctor when I first met him so it must be very apparent through the regular old PCR.
There are a bunch of us who have the combo problem so maybe one of them knows...I'm sorry I just don't but I seriously doubt you have a dual geno, you'd know it if you did I'm pretty sure.
after the geno results and confirmation VL it's probably a good idea to plan on a good strategy meeting with your dr. Unfortunately, I'm aware of little guidance regarding the benefits of back to back txs versus stopping and restarting. However, if you do continue, I believe you should probably approach it as a new tx : 24 weeks and probably with a new dosing regime (eg weight-based ifn and rbv, possibly another ifn). It's quite possible 12-16 weeks of continuing the current approach may do it - but as best I know you're in uncharted waters regarding the likelihood of success. All the best.
Thanks for the help. Originally when I posted I didn't know the exact VL # (my primary doc said "it is about 700") - it is actually 773 so hopefully that's enough for a successful geno test. I'm continuing for now with pegassys and 1200 riba until the genotype and VL tests come back and depending on that we may increase to 1400, do another VL a couple weeks later to see if I can reach UND. I'm ready to do another 12-16 weeks - Jim, as you say, since I've invested all this time already it's worth another 12 weeks to reach SVR if I can. my doc is saying the same. Until we figure what's going on, she says it's not in my best interest to stop and deny myself the chance of an eventual sustained response. So until the tests come back I'm continuing. Actually have told them at work I may need to continue another 12 weeks so they are prepared for me missing a day now and then. We'll let you know what happens with the tests. thanks again for your comments and all the info. skip
Forgot to add, that while we may not agree completely on this, that your comment was helpful to me.
adjusting to this new screen format is going to take effort - seems the % of screen space left for thread content has dwindled to less than a third..
one reason to stay on the meds until the geno test results are in is learning the identity of the survivors. The tx failure is more likely due to garden-variety breakthough that to mutiple strains... but it's still worth getting those results. Genotype tests require VL above a certain level. If they couldn't run a successful test you may need to do another draw. If in the meantime you stop the meds, the suppressed strain is quite likely to return and may quickly outcompete the recently emerged survivors (which is why they didn't show up on the original test).
I believe Jim meant to write that the abstract uses the word "adequate" with respect to flat-dose in his post above (see the last sentence of the abstract). Also, I finally got access to the journal text and am including the following excerpt which may be of interest to other g2/3s:
"In the current study, 48 weeks of therapy offered no apparent advantage over 24 weeks for patients with G2/3; WBD RBV, although achieving a numerically higher SVR (61.8% versus 59.5%), offered no overall statistical advantage over FD RBV. The trend toward lower efficacy of FD RBV in heavier patients (Fig. 2) may not have been sufficient to affect the results in the overall cohort because of sample size, but this issue warrants further evaluation in other studies. The current study, with its larger patient population and identical PEG-IFN doses in both treatment arms, establishes more firmly the conclusions about the equivalence of 24 and 48 weeks of treatment in patients with G2 and G3 reached by Hadziyannis et al.[10] in their study of PEG-IFN alfa-2a. "
The 61.8 vs 59.5 is noise, but the data presented in their Figure 2 makes a somewhat more compelling argument for WBD even for some g2/g3s. Under WBD, the three weight groups experienced near-same SVR rates (64,59,61) whereas under flat there was a somewhat wider discrepancy (63,55,55). It could be noise - but those two 55s look a bit under-dosed (and your HgB value of 13.4 looks a bit too healthy for a riba victim!) Anyway, something to think about for your next round . Best wishes.
PS: another point from that study (and this was a BIG patient group and very careful stats) is that extending to 48 for g2/g3s sure doesn't seem to gain much. Focusing on different dosage seems the more promising approach for re-tx.
one reason to stay on the meds until the geno test results are in is learning the identity of the survivors. The tx failure is more likely due to garden-variety breakthough that to mutiple strains... but it's still worth getting those results. Genotype tests require VL above a certain level. If they couldn't run a successful test you may need to do another draw. If in the meantime you stop the meds, the suppressed strain is quite likely to return and may quickly outcompete the recently emerged survivors (which is why they didn't show up on the original test).
I believe Jim meant to write that the abstract uses the word "adequate" with respect to flat-dose in his post above (see the last sentence of the abstract). Also, I finally got access to the journal text and am including the following excerpt which may be of interest to other g2/3s:
"In the current study, 48 weeks of therapy offered no apparent advantage over 24 weeks for patients with G2/3; WBD RBV, although achieving a numerically higher SVR (61.8% versus 59.5%), offered no overall statistical advantage over FD RBV. The trend toward lower efficacy of FD RBV in heavier patients (Fig. 2) may not have been sufficient to affect the results in the overall cohort because of sample size, but this issue warrants further evaluation in other studies. The current study, with its larger patient population and identical PEG-IFN doses in both treatment arms, establishes more firmly the conclusions about the equivalence of 24 and 48 weeks of treatment in patients with G2 and G3 reached by Hadziyannis et al.[10] in their study of PEG-IFN alfa-2a. "
The 61.8 vs 59.5 is noise, but the data presented in their Figure 2 makes a somewhat more compelling argument for WBD even for some g2/g3s. Under WBD, the three weight groups experienced near-same SVR rates (64,59,61) whereas under flat there was a somewhat wider discrepancy (63,55,55). It could be noise - but those two 55s look a bit under-dosed (and your HgB value of 13.4 looks a bit too healthy for a riba victim!) Anyway, something to think about for your next round . Best wishes.
PS: another point from that study (and this was a BIG patient group and very careful stats) is that extending to 48 for g2/g3s sure doesn't seem to gain much. Focusing on different dosage seems the more promising approach for re-tx.
Thanks for the well wishes. I believe we are going to do my VL in two weeks so will know if things are getting worse or better. If worse then quitting and taking a nice long rest sounds just right! My doc mentioned that as the option she is leaning toward. We will see how the next month plays out. I've been trying to avoid epo or the other injection (can't remember the name) and I think my counts are ok right now. I adjusted to 1200 easily at the beginning so will consider 1400 going forward. Not clear what to expect from higher dose.
Anxious to have the genotyping test back. NYGirl, how did they determine you have 1a and 1b? From one test? I'm wondering if I have two strains could I have found that out long ago and done tx differently. Am told the test only shows the dominant strain (in my case, 2b), but is there a way to know if you have another. If my test comes back a different genotype than 2b, it will be a whole new ballgame I guess. That would seem to say that I cleared 2b and the new dominant strain would be the other. I have no idea what I'm talking about, but that's my logic. Don't know how the test works.
Will find out soon at any rate.
thanks again all.
skip
Anxious to have the genotyping test back. NYGirl, how did they determine you have 1a and 1b? From one test? I'm wondering if I have two strains could I have found that out long ago and done tx differently. Am told the test only shows the dominant strain (in my case, 2b), but is there a way to know if you have another. If my test comes back a different genotype than 2b, it will be a whole new ballgame I guess. That would seem to say that I cleared 2b and the new dominant strain would be the other. I have no idea what I'm talking about, but that's my logic. Don't know how the test works.
Will find out soon at any rate.
thanks again all.
skip
Don't have my calculator handy, but from the WIN-R study --
85 to < 105 kg - 1200 mg/day, and 105-125 kg - 1400 mg/day.
Please do the math, but I suppose at your new weight, you'd be marginal 1200-1400 -- however, many of us stay at the same dose we started treatment at -- and perhaps the studies do that to too? -- so factoring that thought in (a lot of folks lose wgt during tx) then that argues for 1400 mg/day.
However, it's not just the dose, but your overall strategy. If you decide to committ to extended treatment based on getting UND in the next few weeks, then I personally would push the envelope to 1400 and depending on side effects,etc, perhaps start Procrit (epo) at the same time. After that, as already posted, I would have my VL tested religiously every two weeks and stop if another breakthrough. Equally reasonable is simply stopping now as NYGirl and others have suggested.
All the best,
-- Jim
85 to < 105 kg - 1200 mg/day, and 105-125 kg - 1400 mg/day.
Please do the math, but I suppose at your new weight, you'd be marginal 1200-1400 -- however, many of us stay at the same dose we started treatment at -- and perhaps the studies do that to too? -- so factoring that thought in (a lot of folks lose wgt during tx) then that argues for 1400 mg/day.
However, it's not just the dose, but your overall strategy. If you decide to committ to extended treatment based on getting UND in the next few weeks, then I personally would push the envelope to 1400 and depending on side effects,etc, perhaps start Procrit (epo) at the same time. After that, as already posted, I would have my VL tested religiously every two weeks and stop if another breakthrough. Equally reasonable is simply stopping now as NYGirl and others have suggested.
All the best,
-- Jim
skip
Just so you know - I have two genotypes 1A and 1B and the doctor told me it doesn't really make a difference (even though my BRAIN tells me it would be harder to get rid of one than the other). But it's not true. After 72 weeks I am SVR.
Because you have such little liver damage and your alt/ast are so good if I was you I'd take a nice long rest before deciding to treat again. I can't imagine how hard it is ... I just can't.
You have time so make sure you continue with your liver enzyme tests and follow up biopsies just to make sure - I'd wait too probably. However I had no choice really at stage 3.
it is interesting the timing of the riba reduction and the breakthrough - so many docs are SO adament about no reductions and all that but remember...treatment is a giant crapshoot regardless and that's all.
I hope you enjoy the new year and get about life again quickly!
Best of luck.
Just so you know - I have two genotypes 1A and 1B and the doctor told me it doesn't really make a difference (even though my BRAIN tells me it would be harder to get rid of one than the other). But it's not true. After 72 weeks I am SVR.
Because you have such little liver damage and your alt/ast are so good if I was you I'd take a nice long rest before deciding to treat again. I can't imagine how hard it is ... I just can't.
You have time so make sure you continue with your liver enzyme tests and follow up biopsies just to make sure - I'd wait too probably. However I had no choice really at stage 3.
it is interesting the timing of the riba reduction and the breakthrough - so many docs are SO adament about no reductions and all that but remember...treatment is a giant crapshoot regardless and that's all.
I hope you enjoy the new year and get about life again quickly!
Best of luck.
skip
Just so you know - I have two genotypes 1A and 1B and the doctor told me it doesn't really make a difference (even though my BRAIN tells me it would be harder to get rid of one than the other). But it's not true. After 72 weeks I am SVR.
Because you have such little liver damage and your alt/ast are so good if I was you I'd take a nice long rest before deciding to treat again. I can't imagine how hard it is ... I just can't.
You have time so make sure you continue with your liver enzyme tests and follow up biopsies just to make sure - I'd wait too probably. However I had no choice really at stage 3.
it is interesting the timing of the riba reduction and the breakthrough - so many docs are SO adament about no reductions and all that but remember...treatment is a giant crapshoot regardless and that's all.
I hope you enjoy the new year and get about life again quickly!
Best of luck.
Just so you know - I have two genotypes 1A and 1B and the doctor told me it doesn't really make a difference (even though my BRAIN tells me it would be harder to get rid of one than the other). But it's not true. After 72 weeks I am SVR.
Because you have such little liver damage and your alt/ast are so good if I was you I'd take a nice long rest before deciding to treat again. I can't imagine how hard it is ... I just can't.
You have time so make sure you continue with your liver enzyme tests and follow up biopsies just to make sure - I'd wait too probably. However I had no choice really at stage 3.
it is interesting the timing of the riba reduction and the breakthrough - so many docs are SO adament about no reductions and all that but remember...treatment is a giant crapshoot regardless and that's all.
I hope you enjoy the new year and get about life again quickly!
Best of luck.
skip
Just so you know - I have two genotypes 1A and 1B and the doctor told me it doesn't really make a difference (even though my BRAIN tells me it would be harder to get rid of one than the other). But it's not true. After 72 weeks I am SVR.
Because you have such little liver damage and your alt/ast are so good if I was you I'd take a nice long rest before deciding to treat again. I can't imagine how hard it is ... I just can't.
You have time so make sure you continue with your liver enzyme tests and follow up biopsies just to make sure - I'd wait too probably. However I had no choice really at stage 3.
it is interesting the timing of the riba reduction and the breakthrough - so many docs are SO adament about no reductions and all that but remember...treatment is a giant crapshoot regardless and that's all.
I hope you enjoy the new year and get about life again quickly!
Best of luck.
Just so you know - I have two genotypes 1A and 1B and the doctor told me it doesn't really make a difference (even though my BRAIN tells me it would be harder to get rid of one than the other). But it's not true. After 72 weeks I am SVR.
Because you have such little liver damage and your alt/ast are so good if I was you I'd take a nice long rest before deciding to treat again. I can't imagine how hard it is ... I just can't.
You have time so make sure you continue with your liver enzyme tests and follow up biopsies just to make sure - I'd wait too probably. However I had no choice really at stage 3.
it is interesting the timing of the riba reduction and the breakthrough - so many docs are SO adament about no reductions and all that but remember...treatment is a giant crapshoot regardless and that's all.
I hope you enjoy the new year and get about life again quickly!
Best of luck.
skip
Just so you know - I have two genotypes 1A and 1B and the doctor told me it doesn't really make a difference (even though my BRAIN tells me it would be harder to get rid of one than the other). But it's not true. After 72 weeks I am SVR.
Because you have such little liver damage and your alt/ast are so good if I was you I'd take a nice long rest before deciding to treat again. I can't imagine how hard it is ... I just can't.
You have time so make sure you continue with your liver enzyme tests and follow up biopsies just to make sure - I'd wait too probably. However I had no choice really at stage 3.
it is interesting the timing of the riba reduction and the breakthrough - so many docs are SO adament about no reductions and all that but remember...treatment is a giant crapshoot regardless and that's all.
I hope you enjoy the new year and get about life again quickly!
Best of luck.
Just so you know - I have two genotypes 1A and 1B and the doctor told me it doesn't really make a difference (even though my BRAIN tells me it would be harder to get rid of one than the other). But it's not true. After 72 weeks I am SVR.
Because you have such little liver damage and your alt/ast are so good if I was you I'd take a nice long rest before deciding to treat again. I can't imagine how hard it is ... I just can't.
You have time so make sure you continue with your liver enzyme tests and follow up biopsies just to make sure - I'd wait too probably. However I had no choice really at stage 3.
it is interesting the timing of the riba reduction and the breakthrough - so many docs are SO adament about no reductions and all that but remember...treatment is a giant crapshoot regardless and that's all.
I hope you enjoy the new year and get about life again quickly!
Best of luck.
It finally hits me that I've spent 6 months with incentive that the tx was working and now am about to be considered a non-responder.
Willing, yes, I have been doing the Roche Peg-IFN and Riba combo. thanks for the info. As I go forward I will again be talking to my Doc about the reasoning. It looks like the future holds more tx and at least I'll be more knowledgeable going in.
Certain of my test results from yesterday came back: AST 27; ALT 25; WBC 3.2; ANC 1.47; Platelets 192; Hgb 13.4; Hct 39. Am weighing 217.5 today. The ANC is the lowest it has been thru tx. I've started back on 1200 riba yesterday and have four weeks supply of IFN so will continue treatment at least until the tests are back. The genotyping and "HCV RNA by BDNA" tests won't be back for 7-10 days. I woke up this morning and thought why am I continuing with this if ultimately it is not working?
Jim, as you suggested, I believe the goal the doc and I decided is to see after a couple of weeks how my VL is doing and if it is worse then I will stop tx, then, if better, we will discuss again. I'm having a hard time justifying another 24 weeks at work. I made the mistake of telling them I was through with tx this week, and this morning gave them the news that there are few weeks to go. At 217lbs, am I still weight-based for 1400 riba? I sure don't feel very heavy these days! I was small-boned and skinny up until I was 35yrs - 6'4", 135lbs - am still small-boned. Am I to understand that the breakthrough in tx means that for future tx the IFN-riba combo probably won't work? I guess if my genotype comes back a 1 instead of 2 it will be a whole new ballgame. This is my first time with this, and more and more it appears I am going to be going through this again down the road. My doc mentioned that since my liver is in good shape she is inclined to have me wait for trials she will sign me up for when she finds the right ones. My recall is not all that great but she mentioned certain trials involving new drugs that allow for shortened treatment time.
This is all new to me. Nice to know you guys are an email away with all this great information and encouragement. It is a comfort. thanks again. skip
Willing, yes, I have been doing the Roche Peg-IFN and Riba combo. thanks for the info. As I go forward I will again be talking to my Doc about the reasoning. It looks like the future holds more tx and at least I'll be more knowledgeable going in.
Certain of my test results from yesterday came back: AST 27; ALT 25; WBC 3.2; ANC 1.47; Platelets 192; Hgb 13.4; Hct 39. Am weighing 217.5 today. The ANC is the lowest it has been thru tx. I've started back on 1200 riba yesterday and have four weeks supply of IFN so will continue treatment at least until the tests are back. The genotyping and "HCV RNA by BDNA" tests won't be back for 7-10 days. I woke up this morning and thought why am I continuing with this if ultimately it is not working?
Jim, as you suggested, I believe the goal the doc and I decided is to see after a couple of weeks how my VL is doing and if it is worse then I will stop tx, then, if better, we will discuss again. I'm having a hard time justifying another 24 weeks at work. I made the mistake of telling them I was through with tx this week, and this morning gave them the news that there are few weeks to go. At 217lbs, am I still weight-based for 1400 riba? I sure don't feel very heavy these days! I was small-boned and skinny up until I was 35yrs - 6'4", 135lbs - am still small-boned. Am I to understand that the breakthrough in tx means that for future tx the IFN-riba combo probably won't work? I guess if my genotype comes back a 1 instead of 2 it will be a whole new ballgame. This is my first time with this, and more and more it appears I am going to be going through this again down the road. My doc mentioned that since my liver is in good shape she is inclined to have me wait for trials she will sign me up for when she finds the right ones. My recall is not all that great but she mentioned certain trials involving new drugs that allow for shortened treatment time.
This is all new to me. Nice to know you guys are an email away with all this great information and encouragement. It is a comfort. thanks again. skip
Have an Answer?
You are reading content posted in the Hepatitis C Community
Learn about this treatable virus.
Getting tested for this viral infection.
3 key steps to getting on treatment.
4 steps to getting on therapy.
What you need to know about Hep C drugs.
How the drugs might affect you.
These tips may up your chances of a cure.
A list of national and international resources and hotlines to help connect you to needed health and medical services.
Herpes sores blister, then burst, scab and heal.
Herpes spreads by oral, vaginal and anal sex.
STIs are the most common cause of genital sores.
Condoms are the most effective way to prevent HIV and STDs.
PrEP is used by people with high risk to prevent HIV infection.
